Microsatellites
Despite their very futuristic sounding name, conjuring up an image of some kind of high-tech contraption, too small to be seen with the naked eye, orbiting the planet and spying on you, microsatellites have probably been around for billions of years and are completely harmless. They are simply stretches of DNA sequence in which the same few letters repeat themselves several times (for example, atccatccatccatccatccatccatcc or gtgtgtgtgtgtgtgtgtgtgt). They do not do anything important, and the only reason they are interesting is because the repeats tend to confuse the DNA-copying apparatus. What often happens is one too many repeats, or one too few, gets copied, and the two strands of DNA still stick together pretty well, so this doesn't affect any life processes (the extra repeat just bulges out, unpaired). This super-high mutation rate means that any population of living individuals has many different size variants floating around, and so if two individuals have at least one copy in common at several microsatellite loci, the odds are virtually certain that they are parent and offspring or else siblings. Another advantage of using microsatellites to determine relatedness is that you don't have to sequence the DNA, you just have to look for a difference in length (this is often cheaper and quicker). Legal "DNA testing," whether it's matching deadbeat dad to alleged child or murder suspect to blood found at the crime scene, is usually done with microsatellites. Incidentally, this isn't the only word from molecular ecology that sounds like a weapon wielded by an evil bionic sultana; see nuclear and radiation.